What is the genetic code and how does it work?

This is how the genetic code, which is very important for cells, works.

However much morphological diversity we living beings present, we are all united under the same umbrella: our basic functional unit is the cell. If a living being has one cell on which its entire morphological structure is based, it is known as unicellular (the case of protozoa or bacteria), while those of us with several cells (from hundreds to hundreds of billions) are multicellular beings.

Thus, every organism starts from the cell and, for this reason, some molecular entities such as viruses are not considered strictly "alive" from a Biological point of view. In turn, studies have characterized that each cell contains a whopping 42 million protein molecules. It is therefore not surprising that it is estimated that 50% of the weight of dry living tissues is composed solely of proteins.

Why do we provide all these seemingly unrelated data? Today we come to unravel the secret of life: the genetic code. Mysterious as it may seem at first glance, we assure you that you will understand this concept immediately. It's all about cells, proteins and DNA. Stick around to find out.

What is the genetic code?

Let's start in a clear and concise way: the genetic code is nothing more than the set of instructions that tell the cell how to make a specific protein.. We have already said in previous lines that proteins are the essential structural unit of living tissues, which is why this is not an anecdotal question: without proteins there is no life, it is as simple as that.

The characteristics of the genetic code were established in 1961 by Francis Crick, Sydney Brenner and other collaborating molecular biologists. This term is based on a number of premises, but first we must clarify certain terms in order to understand them. Let's get down to it:

• DNA: nucleic acid that contains the genetic instructions used in the development and functioning of all existing living organisms.
• RNA: nucleic acid that performs various functions, including directing the intermediate stages of protein synthesis.
• Nucleotides: the organic molecules that, joined together, give rise to the DNA and RNA chains of living organisms.
• Codon or triplet: every 3 amino acids forming RNA form a codon, i.e. a triplet of genetic information.
• Amino acid: organic molecules which, in a certain order, give rise to proteins. 20 amino acids are encoded in the genetic code.

The basics of the genetic code

Now that we are clear on these basic terms, it is time to explore the main features of the genetic code, established by Crick and his colleagues. the main features of the genetic code, as established by Crick and his colleagues.. These are as follows:

• The code is organized in triplets or codons: every three nucleotides (codon or triplet) codes for an amino acid.
• The genetic code is degenerate: there are more triplets or codons than amino acids. This means that an amino acid is usually encoded by more than one triplet.
• The genetic code is non-overlapping: a nucleotide only belongs to a single triplet. That is, a specific nucleotide is not in two codons at the same time.
• The reading is "without commas": we do not want to incur in too complex terminology, so we will say that there are no "spaces" between codons.
• The nuclear genetic code is universal: the same triplet in different species codes for the same amino acid.

Unraveling the genetic code

We already have the terminological bases and the theoretical pillars. Now it's time to put them into practice. First of all, we will tell you that each nucleotide receives a name based on a letter, which is conditioned by the nitrogenous base that it has. The nitrogenous bases are the following: adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U). Adenine, cytosine and guanine are universal, while thymine is unique to DNA and uracil is unique to RNA. If you see this, what do you think it means:

CCT

CCU

It is time to retrieve the terms described above. CCT is part of a DNA strand, i.e. 3 distinct nucleotides: one with the cytosine base, one with the cytosine base and one with the thymine base. In the second case of bold letters we are dealing with a codon, since it is the genetic information of DNA "translated" (hence there is a uracil where before there was a thymine) into an RNA strand.

Thus, we can state that CCU is a codon coding for the amino acid proline. As mentioned above, the genetic code is degenerate. Thus, the amino acid proline is also coded by other codons with different nucleotides: CCC, CCA, CCG. Thus, the amino acid proline is encoded by a total of 4 codons or triplets.

It should be noted that it is not that all 4 codons are needed to encode the amino acid, but that any one of them will do. In general, essential amino acids are encoded by 2,3,4 or 6 different codons, except for methionine and tryptophan, which only respond to one codon each. which only respond to one each.

Why so much complexity?

Let's do the math. If each codon were encoded by only one nucleotide, only 4 different amino acids could be formed. This would make protein synthesis an impossible process, since in general each protein is composed of about 100-300 amino acids. There are only 20 amino acids encompassed in the genetic code, but these can be ordered in different ways.However, these can be arranged in different ways along the "assembly chain" to give rise to the different proteins present in our tissues.

On the other hand, if each codon were made up of two nucleotides, the total number of possible "diplets" would be 16. We are still far from the goal. However, if each codon consisted of three nucleotides (as is the case), the number of possible permutations would increase to 64. Taking into account that there are 20 essential amino acids, 64 codons are enough to encode each one of them and, on top of that, to offer different variations in each case.

An applied view

We are running out of space, but it is truly complex to concentrate so much information in a few lines. Follow us in the following outline, because we promise you that closing all this terminological conglomerate is much simpler than it seems:

CCT (DNA) → CCU (RNA) → Proline (ribosome).

This little diagram expresses us the following: the cellular DNA contains the 3 CCT nucleotides, but it cannot "express" the genetic information, since it is isolated from the cellular machinery in the cell nucleus.. Therefore, the enzyme RNA polymerase is in charge of TRANSCRIBING (process known as transcription) the DNA nucleotides into RNA nucleotides, which will form the messenger RNA.

Now we have the CCU codon in the messenger RNA, which will travel out of the nucleus through its pores to the cytosol, where the ribosomes are located. In summary, we can say that the messenger RNA gives this information to the ribosomewhich "understands" that the amino acid proline must be added to the amino acid sequence already constructed to give rise to a specific protein.

As mentioned above, a protein is composed of about 100-300 amino acids. Thus, any given protein formed from the arrangement of 300 amino acids will come encoded by a total of 900 triplets (300x3) or, if you prefer, by 2,700 nucleotides (300x3x3). Now, imagine each of the letters of each of the 2,700 nucleotides, something like: AAAUCCCCCCGGUGAUUUAUAUAUAAGG (...) It is this arrangement, this conglomeration of letters, which is really the genetic code. Easier than it seemed at first, right?

Summary

If you ask any biologist interested in molecular biology about the genetic code, you will probably have a conversation for about 4-5 hours. It is truly fascinating to learn that the secret of life, as unreal as it may seem, is locked in a specific sequence of "letters".

Thus, the genome of any living being can be mapped with these 4 letters. For example, according to the human genome project, all the genetic information of our species is composed of 3 billion base pairs (nucleotides), which are found in the 23 pairs of chromosomes inside the nucleus of all our cells. Of course, as different as we living beings are, we all present a common "language".

Bibliographic references:

• What is the genetic code? genotipia.com. Retrieved from: https://genotipia.com/codigo-genetico/
• Asimov, I., & de la Fuente, A. M. (1982). The genetic code (No. Sirsi) i9789688561034). Plaza & Janés.
• Genetic code, National Human Genome Research Institute. Retrieved from: https://www.genome.gov/es/genetics-glossary/Codigo-genetico
• Genetic code: characteristics and deciphering, Universidad Complutense de Madrid (UCM). Retrieved from: https://www.ucm.es/data/cont/media/www/pag-56185/08-C%C3%B3digo%20Gen%C3%A9tico-caracter%C3%ADsticas%20y%20desciframiento.pdf
• The genetic code, Khanacademy.org. Retrieved from: https://es.khanacademy.org/science/ap-biology/gene-expression-and-regulation/translation/a/the-genetic-code-discovery-and-properties
• It's official: there are 42 million protein molecules in every cell, europapress.com. Retrieved from: https://www.europapress.es/ciencia/laboratorio/noticia-oficial-hay-42-millones-moleculas-proteina-cada-celula-20180117181506.html
• Lee, T. F. (1994). The Human Genome Project: cracking the genetic code of life (No. Sirsi) i9788474325072).